rkoant08 rkoant08

21-10-2022
Mathematics

contestada

Graph the line perpendicular to the line y = 4(x-3)+2 and goes through (1,4).

Respuesta :

Otras preguntas

Which of the following forms of evaluation are used to understand whether or not your idea is having the intended effect and lets you know if you met your objec

We develop canned plans and scripts from our own current experiences and by observing what appears to work or not work for other people, even fictitious people

564 grams of copper how many moles

how many gallons of milk would you have if you purchased 15.14 liters

Rewrite the following equation in standard form. y = 3x – 8

HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT

using any of the four operations place one sign. between each pair of digits from 1 to 9 to arrive to an expression with the least possible value. you may use b

The human population of the world is about 7,530,000,000. In scientific notation

According to O*NET, what are common tasks performed by Tour Guides? Check all that apply. Click this link to view O*NET's Tasks section for Tour Guides. Note th

In calculating the monthly payment for a loan with an 8. 5% interest rate compounded monthly, what value should be used for i, the interest rate per period, as