isamilo7438 isamilo7438

21-10-2022
Mathematics

contestada

an insurance company is issuing 20 home insurance policies. suppose the probability for a claim during a year is 15 percent. what is the probability that there will be more than 5 claims during the year?

Respuesta :

Otras preguntas

Which name does the monk who travels to the west not use

7- What types of RNA are present in a cell and how can you selectively make copies of only the mRNAs?

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Explain the importance of spore formation for both eukaryotes and prokaryotes.

Find the commission on a $750.00 sale if the commission is 24%. $166.00 $180.00 $131.25 $201.00

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

1. Obligate anaerobes are often grown in an anaerobe jar, which completely excludes oxygen from the environment. How is the environment within a tube of fluid t

you just bought a new hard drive for your computer, you plan to use this secondary hard drive to store all school work files. once installed, what needs to be d

Discuss at least two effects on U.S. citizens that stem from the division of power between the federal and state governments.

1.Why is the coding sequence (whether DNA or RNA) at least three times as long as the protein sequence it codes for? 2.How can the DNA sequence be so different