kevinmedina0902 kevinmedina0902

22-01-2023
Biology

contestada

DNA Never leaves the Nucleus of the cell. This is why you need RNA. In Transcription, DNA is
transcribed into a strand of RNA.
DNA has Adenine, Thymine, Cytosine, Guanine
RNA has Adenine, Uracil, Cytosine, Guanine
Transcription of DNA to RNA
ATGCCTAAGCCGTGTCCGAT

Respuesta :

Otras preguntas

how did the loss of the Buffalo affect native Americans?

What is -0.9 if I turn it into a fraction in simplist form?

Write these fractions in decimal form 4/10, 62/100, & 38/100.

Why do tissues team up to form organs

Geographic barriers can influence groups of people to form cultures in isolation because they prevent the influence of outside factors. a. True b. False

Consuelo living room is in the shape of a rectangle and haa an area of 360 square feet. the width of the livingroom is 5/8 its lenght. what is the lenght of the

15 over 100 simplified to the lowest form

Find the sum of 5x+20 and the opposite of 20. Write an equivalent expression in standard form.

forest mangers sometimes start small fires in order to

During the 700s, most of Spain was conquered by the __________. Germanic barbarians Muslims Byzantines Huns