lovebelt
lovebelt lovebelt
  • 25-05-2023
  • Mathematics
contestada

100PT! Which of the following steps will help prove that triangle FBD is equilateral?

Prove that DA, EF, and CB are parallel.
Prove that angles A, B, C, D, E, and F are congruent.
Prove that triangles BDC, DFE, and FBA are congruent.

100PT Which of the following steps will help prove that triangle FBD is equilateral Prove that DA EF and CB are parallel Prove that angles A B C D E and F are c class=

Respuesta :

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
the sale price of a bicycle is $120 this is 75% of the original price find the original price
what is the main point being made by the cartoonist documeny E
a jet takes 5 3/4 hours to fly 2,475 mi from new york city to los angeles. about how many hours will a jet flying at the same average rate take to fly 5,452 mi
If 1+4=5 and 2+5=12 what does 8+11=
list the six external parts of a computer system and identify which are output and which and which are input devices
as a medical administrative assistant at Saint Catherine Children’s Hospital, write an email message to your supervisor that will be read on a mobile device de
a speech is considered what type of text
who is the first presiden of United States?
of the 600 workers at a factory, 8.5% belong to a union. how many workers are in the Union?