jadamichel07 jadamichel07

22-02-2024
Mathematics

contestada

Which form of fuel does not have any known disadvantages, according to information provided in lecture?
(a) wind,
(b) solar,
(c) geothermal,
(d) biomass,
(e) none the above.

Respuesta :

Otras preguntas

6. Why is crossing over, or recombination, in meiosis a genetic advantage for a n organism? Why is crossing over an advantage for a geneticist

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Where does the water in streams and rivers originate? a. precipitation b. runoff c. ice and snowpacks d. all of the above

Which muscle below is a 2nd class lever? A) Gastrocnemius B) Biceps Brachii C) Flexor carpi ulnaris D) Extensor carpi ulnaris

In a recent year, certain colleges and universities received about $268 million in aid. Ten years later, they received about $94 million. Find the percent of ch

Identify the parts of the human body that normally contain bacteria

Which of the following examples would be classified as a dependent clause? A. whirling through the yellow-colored sky B. the mile-wide black tornado roared C.

What is the second Vatican council?

when addressing an envelope for delivery in the united states or canada, the zip code should appear where

If the unit selling price is 2.50 and the unit cost is 1.00, what action is needed to maintain the gross margin percentage when unit cost increases 0.25?