jacworkman
jacworkman
22-04-2024
Mathematics
contestada
8x+4y=-24
-5x+4y=-11
Respuesta :
VER TODAS LAS RESPUESTAS ( 35+ )
Otras preguntas
What does the change of color in an experimental group indicate about the size of starch in relation to the pore size of the membrane?
Which of the following functions would be performed in practice management software? 1) Entering physical exam data 2) Capturing demographic information 3) Vita
What is the velocity of a first-order reaction at 37°C when the reactant concentration is 6*10⁻2 M and the rate constant is?
Um predio de 300 m de altura em uma determinada hora do dia projeta uma sombra de 1.500 m, responda: a) Desenhe a situação e identifique que figura geométrica
As the price of all food has increased from $29.9950 to $33.9989 per day, the quantity demanded of calories has decreased from 3750.0059 to 3600.2500 per day. a
A laboratory information system uses an algorithm based on the delta check process to identify erroneous results. this process is a part of which lis function?
The type and number of jobs required to complete the work of a firm are usually described by which factors?A. Formal and informal.B. Centralization and decentra
Example 1. Suppose that the function y = f(x) is given by the graph below, and that the pieces of f are either portions of lines or portions of circles. In addi
_________________ is the degree to which nonmembers of a group evaluate a group and its members either positively or negatively Group of answer choices A.Public
4. PCR Primer design (4 points) You have a piece of DNA that includes the sequence: 5'GATGAGGATGAGGAGAAGTACCGGCCGCCGCCTGCGCATCACAATATGTTCAGT 3' To amplify this
