SageMinimumWage SageMinimumWage

23-04-2024
Mathematics

contestada

Please help and explain!! Find the surface area and the volume of the solid to the nearest tenth.

Please help and explain Find the surface area and the volume of the solid to the nearest tenth class=

Respuesta :

Otras preguntas

Mrs. Gannon is having her class make a winter decorations using pine cones. If each decoration needs 11 pine cones and Mrs. Gannon ha 18 students in her class.

can you please help me please

Mrs. Toomer brought 40 cookies to school. Mrs. Toomer's class ate 1/2 the cookies. Mrs. Wilson's class ate 1/4 of the remaining cookie. How many cookies are

What is the power output of an electric motor that lifts a 2.0 kilogram block 15 meters vertically in 6.0 seconds

What's x² + 2x + 1 factorised?

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

What is a vestigial organ

what's the possibility of choosing a spade in a deck of 52 cards?

the expression 4X gives the perimeter of a square with a side length of X units. what is the perimeter of a square with a side length of 5/7 units?

what finger does the ring go on