Bhoom3983 Bhoom3983

25-10-2019
Mathematics

contestada

About 1414% of the population of a large country is nervous around strangersnervous around strangers. If two people are randomly selected, what is the probability both are nervous around strangersnervous around strangers? What is the probability at least one is nervous around strangersnervous around strangers?

Respuesta :

25-10-2019

One person being nervous around strangers is assumed independent of other people behaviour. Then, the multiplication rule can be applied as

both nervous = 0.14*0.14 = 0.0196 = 1.96%

one is nervous, one is not nervous = 0.14*(1-0.14) = 0.1204 = 12.04%

At least one nervous = 1.96% + 12.04% = 14%

Answer Link

Otras preguntas

to the form American society? MAKE INFERENCES How would serving in World War II affect the expectations of Latinos returning to the United States after the war?

Codons Which amino acids does this mRNA strand code for? *You must spell out the entire name of the amino acid* 5'CCGGAUGUCCGUAUAACGGC3'

Load the Reuters Corpus provided in the NLTK library, which is a collection of news articles classified into different categories. a. Use the Reuters Corpus to

What is the equivalent resistance of a 30 Omega, a 45 Omega and a 25 Omega resistor connected in series? 1) 100 Omega 2) 65 Omega 3) 14 Omega 4) 12 Omega 5) 85

Is the question "Have you ever been injured on the job?" an illegal question? 1) True 2) False

This is the logo used on goods supplied by a government aid program to Europe from 1948 to 1953. How did the Soviet Union respond to this program? 4 It establis

after carrying out fhe experiment,Amin will make some important steps to enable the problem to be solved.Explain the steps to be taken by Amin.

Por qué es importante pensar en lo que come como una elección de alimentos y no como una "dieta"

Which of the following conditions make a late mover advantage possible? 1) Imitators can easily follow 2) Innovative firms 3) There is a high rate of change in

A chess match lasted 3 1/4 hours The match finished at 14 10 What time did the chess match start