breannagrd5069 breannagrd5069

24-01-2020
Physics

contestada

Find the direction of the net electric force exerted on a charge Q, located at the center of the square, for the following arrangement of charge: the two positive charges are on the top corners, and the two negative charges are on the bottom corners.

Respuesta :

oeerivona oeerivona

26-01-2020

Answer:

Downwards towards the square bottom

Explanation:

The direction of the net electric force exerted on the charge +Q is downwards, towards the bottom of the square as the two positive charges at the top are repulsive on the charge Q pushing it down while the negative charges on the bottom corners tend to attract the positive charge Q downwards pulling it towards them

Answer Link

Otras preguntas

As the foundation of moral development, phase i shows that it is rational to be selfish and that there is no duty to others that can trump a. trueb. false

Consider a single loop of wire shaped into a square with side length 1.5m. A time dependent B-field acts normal to the loop with magnitude: B(t) = α t + β sin(ω

How does irony contribute to the theme topic of masculinity in Part 2? A. Okonkwo is exiled to his mother's homeland, for accidentally committing a "female" o

Respiration occurs only in cells were no photosynthesis is taking place.a. True b. False

Describe the series of steps that are involved in the formation of DNA/RNA chain?

Calculate √{{1+√{{1-√{{1-√{{1+{√{3}}/{2}}/{2}}}/{2}}}/{2}}}/{2}}As usual, the output of an inverse trig function should be in radians.

4. PCR Primer design (4 points) You have a piece of DNA that includes the sequence: 5'GATGAGGATGAGGAGAAGTACCGGCCGCCGCCTGCGCATCACAATATGTTCAGT 3' To amplify this

If the status of a UII is unknown at the time you are receiving the asset, the status can be marked as: a) Delivered b) Received c) Pending d) Lost

List the five steps to determine the distance to a star using spectroscopic parallax?

Determine the values of if − ≤ ≤ 4 given that sin = −0.05