Seudónimo Seudónimo

24-04-2020
Mathematics

contestada

Which numbers are irrational? Select all that apply.

Which numbers are irrational Select all that apply class=

Respuesta :

ckayep0cx2v ckayep0cx2v

24-04-2020

Answer:

[tex]\sqrt{18}[/tex] , [tex]\sqrt{78}[/tex] , and π

Step-by-step explanation:

The irrational numbers are:

[tex]\sqrt{18}[/tex] , [tex]\sqrt{78}[/tex] , and π

Answer Link

Jaycedblash Jaycedblash

12-01-2021

Answer:

King Vamp ‍♂️

Step-by-step explanation:

Answer Link

Otras preguntas

a piece of metal weighing 18.4 g is heated to raise its temperature from 21.7 oc to 53.5 oc. it is found that the metal absorbed 262 j of heat in the process. C

which of the following is needed for a computer system or device to be vulnerable to malware? an internet connection an operating system a logged on user

Phil is mixing paint colors to make a certain shade of purple. His small can is the perfect shade of purple and has 4 parts blue and 3 parts red paint. He mixes

You have observed two foxes mating and producing 3 red offspring and 1 white offspring. True/False: Both parents are heterozygous (Rr) for this trait Responses

a certain reaction has an activation energy of 49.06 kj/mol. at what kelvin temperature will the reaction proceed 7.50 times faster than it did at 323 k?

Which of the following explains how David Hockney used technology in his painting Bigger Trees Near Water? a Digital stencil b Screen printing c Digital phot

what is the speed vf of an electron at the fermi energy of gold? for now, neglect the effects of relativity. express your answer in meters per second to two sig

How did the collapse of government lead to the time of the Warring States? Chinese dynasties

Which of the strands of DNA could act as a primer for the DNA sequence shown below? 5 ' CCCTGGGCTCTGTAAATGTTTCTAAGTG -3' 3' GGGACCCGAGACATTTACAAAGATTCAC -5' A:

Complete the following tasks on Building A > Floor 1 > Office1 > Office1: Based on the content of the email messages, delete any emails that have poten