mattmen06 mattmen06

21-05-2020
English

contestada

Which of the following words from the narrative help you visualize the sequence of events?
a.
first
c.
eventually
b.
then
d.
all of the above

Respuesta :

alaskasabrinasnow alaskasabrinasnow

21-05-2020

D. All of the above

They all help describe order of events and visualize them

Answer Link

Otras preguntas

there are 24 kids the class 15 kids like blue what is the percent of kids do not like blue

4. An immense body of air characterized by similar properties at any given altitude is known as O an anticyclone a cyclone a front an air mass

The market value of a vacant site can be determined using: O the cost approach of appraisal. O the comparative approach of appraisal. O the accrual approach of

L. Facing Death 1. August Strindberg 2080 Set C Q.No. 3b Do you think money is the chief determinant of maintaining relationship between characters in the play

The graph indicates the running route for Tobias. A graph with horizontal axis time (seconds) and vertical axis position in (meters). The line runs in straight

What are - crystals define ?

Codons Which amino acids does this mRNA strand code for? *You must spell out the entire name of the amino acid* 5'CCGGAUGUCCGUAUAACGGC3'

How many rings are present in 1,2,3,4-tetra-tertbutyl-tetrahedrane (molecular formula: C20H36), which has no pi bonds?

Consider an electric bicycle of mass 25kg with center of mass approximately half way between the two wheels at a height h above the ground. The bike moves forwa

Question 2 Mark this question When it comes to foreign policy, realists are more likely to advocate the use of while liberals are more likely to advocate the us