montgomerybunston montgomerybunston

22-09-2020
Biology

contestada

a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

Respuesta :

oceanbluewater3000 oceanbluewater3000

22-09-2020

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

Answer Link

Otras preguntas

Use the model to solve for x. A) x = 2 B) x = 4 C) x = 8 D) x = 12

what are the reasons of alcohol use in our country

The formation of diverticula involves most significantly the

The value of loga (30a)^3 is

The process of learning by making mistakes and by trial and error is called

Write down three of the oxymorons juliet uses to describe romeo and explain why she uses this literary texhnique

Why does japans location on the pacific rim put it at particular risk of tsunamis?

In the introduction to Princess, Sultana tells the reader that, “It is wrong, however, to blame our Muslim faith for the lowly position of women in our society.

Which of these evaporative control valve(s) is/are normally open? A. Canister vent valve B. Canister purge valve C. Neither the canister purge nor canister ven

In a newborn infant, torticollis resulting from a tissue tumor most likely involves which of the following muscles?