Seudónimo Seudónimo

22-09-2016
Mathematics

contestada

Is 130 divisible by 2, 5, or 10? Write yes or no. What rule can you use to figure out if a number is divisible by 2, 5, or 10?

a. by 2?
b. by 5?
c. by 10?

Respuesta :

22-09-2016

Yes to all 3. Any number that is an even number is divisible by 2, any number that ends in 5 or 0 is divisible by 5, and any number that ends in 0 (except 0) is divisible by 10.

Answer Link

Otras preguntas

a body of mass 10 kg is moving with velocity of 10ms-1.a force acts for 5 seconds to reduce its velocity to 2ms-1.find the momentum of the body before and after

Which detail from the story best explains why Maria Elisa wants to give Mrs. Robertson a Chia Pet? A. "But I've chosen something that is even better." (Paragrap

¿crees que el estado nación mexicano pudo haberse conformado de una manera distinta de tal manera que en la actualidad perteneciéramos a los países de primer mu

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

2. Select and add adjectives to make noun phrases in each sentence to complete it. Example: While we were playing on the ground, we saw a bright yellow snake. (

Espai A house on the market was valued at $224,000. After several years, the value decreased by 9%. By how much did the house's value decrease in dollars? What

Rocky point brewery (rpb) filed an initial public offering in january 20x3. Rpb engaged olsen & alain, cpas (o&a) in 20x0 to keep the books and prepare

According to your The Hatchet: Brian's Changing Attitudes chart, in Chapter 9, Brian uses the hatchet to __________ 1. cut willows for braces. 2. start a fire.

Investigators are studying a signaling pathway in which an RTK activates the monomeric GTPase Ras. a. True b. False

Stories can be told well in movies, but the best way to tell a story is in the pages of a novel. Novelists can develop characters fully and sustain readers' sus