Using the same, non-mutated sequence of DNA , repeat the process you just completed, but this time, for an insertion mutation. Randomly insert a base.

Original DNA gene: GATCGATACCATTCGGCGCATACTTCG

A)The mutated DNA sequence; highlight the insertion mutation.

B)The resulting MRNA sequence for each mutation:


C) The resulting amino acid sequence for each mutation (you will need the codon wheel chart for this):

Note: Begin translation at the first start codon, AUG, that you see when reading the MRNA sequence from left to-right. Stop translating the sequence when you reach first stop codon in the reading frame.