nitrellhorton2004 nitrellhorton2004

26-02-2021
Physics

contestada

The amount of electrons that an atom loses, shares or gains is the ________________.

Respuesta :

fakoredevictoria15 fakoredevictoria15

26-02-2021

It’s known as valency

Answer Link

Otras preguntas

which statements are true? select three options.

Most of australiaas population live in which part of the cpuntry?

The number of faculty and the number of students in a random selection of small colleges are shown. find the equation of the regression line when {eq}x {/eq} is

तपाईंको प्रदेशको भौगोलिक अवस्थिति सम्बन्धमा एक अनुच्छेद तयार गर्नुहोस् ।

Which of the strands of DNA could act as a primer for the DNA sequence shown below? 5 ' CCCTGGGCTCTGTAAATGTTTCTAAGTG -3' 3' GGGACCCGAGACATTTACAAAGATTCAC -5' A:

A firm sells a single product for $65 per unit. Variable cost per unit is $20 for materials and $27.50 for labor. Annual fixed cost is $100,000. Construct the p

How many grams of Fe are required to react with 162.8 grams of CuO?

In cell F2, enter a formula using COUNTIFS to count the number of rows where values in the range named Cost have a value less than 500 and cells in the range na

The activation of long chain fatty acids requires which of the following components? Α. ΑΤΡ B. ATP and COA C. ATP, COA and fatty acyl COA D. Fatty acyl carnitin

the describes the changes in population composition that accompany the shift toward lower birth rates and death rates that occurs when populations move from bei