studentinquiry studentinquiry

23-03-2021
Biology

contestada

2. You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’.

template DNA 3’ CCTACGGTTCGTACCCCGTATGTGTAACTTGTCAT 5’

Respuesta :

23-03-2021

Answer:

DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’.

Explanation:

Answer Link

Otras preguntas

help me on all them crossword for thee cold war

What does it mean to preserve protect and defend the constitution

pls don’t answer if you don’t know

The stock market dropped 220 points on Monday. It lost another 48 points on Tuesday, and on Wednesday it gained 96 points. What was the amount of change over th

Select the correct answer. Which statement about the central nervous system (CNS) and the peripheral nervous system (PNS) is true? A. The CNS consists of the b

A boat travels 200 miles in 2 hours, at what speed was the boat traveling?

Convert the following equation to Slope-Intercept Form HINT: Slope-Intercept Form is y = mx + b y-8= 3(x + 5)

What is the unit rate for 25 rulers in 5 groups

Choose the correct conjugation AND the correct verb to make the sentence sensical. • ¿A(___) te gusta escuchar música rock? *

2 1 En el partido de fútbol, 8 de cada 20 espectadores eran niñas. Hubo un total de 1560 espectadores en el juego. ¿Cuántos de los espectadores eran niñas? A 13