Seudónimo Seudónimo

26-03-2021
Biology

contestada

HELP I'M STUCK WILL GIVE BRAINLIEST

The DNA strand above is cut with a restriction enzyme at the restriction site 5’-GAATTC-3’. The enzyme makes a staggered cut between the two T’s of the restriction site. Based on this information, write the DNA sequences of the resulting DNA fragments.

ATCGAATTCGTCGCTGAATTCGCCTAACTCCCGTGCCTATATATGGAATTCGCT-3’
TAGCTTAAGCAGCGACTTAAGCGGATTGAGGGACGGATATATACCTTAAGCGA

Respuesta :

amal156student amal156student

26-03-2021

Answer:

i think it's GAATTC

Explanation:

Answer Link

Otras preguntas

Which assessment findings would help the nurse support the diagnosis of the condition of orthostatic hypotension?

Zinc plating (galvanizing) is an important means of corrosion protection. Although the process is done customarily by dipping the object into molten zinc, the m

At a given latitude, ocean water in the so-called "mixed layer" (from the surface to a depth of about 50 m) is at approximately the same temperature due to the

A mathematical equation useful for dilution calculations is Mdil × Vdil = Mconc × Vconc (b) Given the volume and molarity of a CaCl₂ solution, how do you determ

Use the following half-reactions to write three spontaneous reactions, calculate E°cell for each reaction, and rank the strengths of the oxidizing and reducing

Heavy crate sits at rest on the floor of a warehouse. you push on the crate with a force of 400 n, and it doesn't budge. what is the magnitude of the friction f

Which of following statements best expresses the overall theme of the story? No sudden moves

The plane flies from Melbourne to Tokyo at an average speed of 783 km/h The distance from Melbourne to Tokyo is 8352 km. The plane leaves Melbourne at 09:52 loc

In the process of doping a semiconductor, certain impurities are added to increase the electrical conductivity. Explain this process for an n-type and a p-type

Gary Stevens and Mary James are production managers in the Consumer Electronics Division of General Electronics Company, which has several dozen plants scattere