vparis21 vparis21
  • 22-08-2021
  • Mathematics
contestada

Step by step please (variable expression)

Step by step please variable expression class=

Respuesta :

pinkcupcakeyeah pinkcupcakeyeah
  • 22-08-2021

Answer:

139

Step-by-step explanation:

Substitute x for 15.

9(15)+4

Then multiply:

135+4

And then add:

139

Answer Link

Otras preguntas

i need help with all of thies
Why do you think lodge won the debate
Right triangle EFG it is known that the side opposite of acute angle F has a length of 18 inches and the leg adjacent to F has a length of 14 inches. Which of t
calcule ⁴√-16 por favor respondam​
Mike wants to paint one wall of his room. The wall measures 12 feet by 9 feet.on the wall is one square window that measures 4 1/2 feet on each side. Which of t
Think of a time you overcame a challenge or obstacle. Describe the experience in two to three sentences.
The macaw has a large beak that allows it to break through large nuts to get to the sweet fruit and pulp inside. Which of the following would a baby macaw most
a rectangle has an area of 446.4 miles and a base of 18 miles what is the height​
⚠️⚠️⚠️help ⚠️⚠️⚠️⚠️⚠️​
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT