ArtLover02 ArtLover02

22-12-2016
Mathematics

contestada

Determine the number of significant digits in each measurement.
100.5L

A. 4 significant digits

B. 2 significant digits

C. 3 significant digits

D. 1 significant digit

Respuesta :

alkhalidisara alkhalidisara

22-12-2016

4 significant figures. All figures are significant because the zeros are in between two significant digits

Answer Link

Otras preguntas

what is the format of a trial balance

what differences, if any, are there between a list of components derived from a physical inspection and a list of components derived from control panel and syst

Using the following chart, which chain of amino acids would be produced by the sequence of this very short, complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA?

a company has developed a keyboard that is virtually indestructible. it is trying to decide how to get its product into the hands of people like to use their co

due to , the financial markets should adjust the relationship between the interest rate differential of two currencies and the forward premium (or discount) on

if the actual cost for a wbs item is $1,500 and its earned value is $2,000, what is its cost variance, and is it under or over budget? group of answer choices t

according to the webpage organizational standards, usage of bulleted or numbered lists should be avoided to provide organized, easy-to-read text that readers ca

a gas has a density of 2.09 g/l at 100 oc and 1 atm. what is the molar mass of the gas?

which of the following statements does not describe the fourth movement of haydn's op. 33, no. 2 string quartet?

according to tversky and kahneman (1982) the 'bank teller' problem is frequently solved using which heuristic?