26-01-2022
English

contestada

Is "the lampposts stood like silent guards" a metaphor or simile?

Respuesta :

s1072710 s1072710

26-01-2022

Answer:

Similes use the words like or as to compare things

and metaphors directly state a comparison—“Love is a battlefield.”

so the answer would be a simile

Explanation:

Answer Link

Otras preguntas

How do we keep up with a high standard of life?

if you made a stack of nickels 100 inches tall how many would you need

What is the first thing to do to divide mixed number fractions?

This reaction could also be categorized as….???

Read the excerpt from Roll of Thunder, Hear My Cry. “Ah, man, leave me be! All y'all Logans think y'all so doggone much with y'all's new coats and books and shi

Entrepreneurs are self-motivated and recognize opportunities around them. Please select the best answer from the choices provided T F.

What message did the actions of the Kristallnacht send to other Jews?

PLEAS HELP ME!!!!!!!! I NEED THIS IN MY SCHOOL TOMORROW!!!PLEAS!!PLEAS!!........................................................................................

HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT

Which describes a difference between a positive and a negative feedback loop? A. The output of a system keeps conditions within the body absolutely constant onl