CSI Miami: Using DNA to Solve a Robbery
The year is 2023. You are a detective for the Miami Dade Police Department. You’re on the scene of a crime where a man single-handedly just robbed a bank. Luckily, being the ingenious detective that you are, you were able to find a little spot of the man’s blood where he cut his arm as he made his escape through a broken window. You take the blood to the lab so tests can be run.
Unfortunately, no one was able to see the face of the man, so there are no suspects yet. Thanks to a study done in 2022, scientists have now figured which genes in DNA code for which characteristics in a person.
On the next page is a strand of the sample of DNA extracted from the blood at the crime scene. Follow the steps below to help you come up with a sketch of the man who perpetrated this crime.
methionine-leucine-proline = Protein that causes DARK SKIN
methionine-leucine-leucine = Protein that causes LIGHT SKIN
valine-proline-proline-lysine = Protein that causes GREEN EYES
proline-leucine-valine-proline = Protein that causes BLUE EYES
proline-lysine-proline-proline = Protein that causes BROWN EYES
lysine-arginine-threonine-valine-serine-serine = BLOND HAIR
lysine-arginine-threonine-valine-serine-cystine = BLACK HAIR
lysine-arginine-threonine-valine-serine-valine = BROWN HAIR
asparagine-isoleucine-arginine = CURLY HAIR
asparagine-asparagine-isoleucine = STRAIGHT HAIR
leucine-arginine-glutamic acid-arginine = BIG NOSE
leucine-asparagine-arginine-glutamic acid = SMALL NOSE
leucine-asparagine-asparagine-glutamic acid = MEDIUM NOSE
proline-tyrosine-tyrosine-(stop) = SMALL EARS
proline-proline-tyrosine-(stop) = MEDIUM EARS
proline-tyrosine-phenylalanine-(stop) = BIG EARS
Step 1: Decode the DNA into mRNA
Step 2: Decode the mRNA into the corresponding amino acids from pg. 211 of your book. Write the amino acids in the order of the codons from the mRNA.
Step 3: On a separate sheet of paper, draw a sketch of what this person might look like based on the traits you came up with.
DNA: TACGATGAAGGCAATCAAGGGTTCTCCTGTCAAAGTACATTATAGGCAGACTTAGCGGTTGGAATGAAAATC
| | |
AUG
mRNA:
Protein Sequence:
1. Methionine 2. 3.
4. 5. 6.
7. 8. 9.
10. 11. 12.
13. 14. 15.
16. 17. 18.
19. 20. 21.
22. 23. 24.
Step 4: Change the underlined nucleotide to a G. Refigure out your mRNA sequence and resulting amino acids. How would this mutation affect your picture? What kind of mutation did you just create?
Step 5: Answer the following wrap-up questions:
1) When you performed step 1, what enzyme were you imitating?
2) In step 2, what molecule would have brought the amino acids that the codons asked for?
3) In step 2, what molecule would have helped the amino acids line up and attach to one another?
4) In step 2, what connected the amino acids together?
