1600211 1600211

24-04-2022
Mathematics

contestada

What is the equation of the line that passes through the point (-2,-8) and has a slope of 11?

Respuesta :

profereyes12122 profereyes12122

24-04-2022

Answer:

y = 11x +14

Step-by-step explanation:

The work:

[tex]y-y_{0} =m(x-x_{0} )[/tex]

[tex]x_{0} =-2\\y_{0} =-8\\m=11[/tex]

[tex]y-(-8)=11(x-(-2))[/tex]

[tex]y+8=11(x+2)[/tex]

[tex]y=11x+22-8[/tex]

The equation:

[tex]y=11x+14[/tex]

Hope this helps

Answer Link

Otras preguntas

What are some of the hazards that domestic pets like dogs and cats can experience in regard to poisons? How are pets exposed to these poisons? What do you think

The ratio of time student spends on their art project to time the student spends on their science project is 3 to 4 the total amount of time the student spends

Which is a benefit of getting information from a government website? The information will be the most current. The information can be trusted. The information w

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt

Was one of the goals of the United Nations in ww2 to prevent the spread of communism?

ONLY answer one question

What must an individual do BEFORE he or she is allowed to take the Road Test? A) earn his or her driver's license B) score at least 75% on the written test C)

A man fell asleep in his running car one evening. he was brought into the er unconscious. his arterial po2 was 95 mmhg. his arterial pco2 was 40 mmhg. with carb

A file name extension provides what information about a file? the file format the file length the file permissions the file creation date

What is the value of x if 5x+2=5^9