ekongwev8299 ekongwev8299
  • 26-04-2022
  • History
contestada

Which physical feature of the eastern united states was the greatest barrier to the westward migration of early american settlers?.

Respuesta :

mspears65
mspears65 mspears65
  • 26-04-2022
The Appalachian mountains
Answer Link

Otras preguntas

DNA tacaggtacccgaacccaattta
Can somebody help me
In which two sentences does the author use an ironic tone toward the subject
Continental climates are located in what regions
Determine whether the equation represents a direct variation. If it does, find the constant of variation. 2y = 5x + 1 a) not a direct variation b) direct varia
18x39 how do u do Distribute property
The distance from home plate to the pitchers mound is 18.5 meters. For a pitcher capable of throwing at 3.85m/s(86mi/hr), how much time elapses between the rele
ANSWER ASAP! Why were members of the Third Estate frustrated with the French government?
What would mostly likely to happen if green plant exposed to less sunlight?
George Washington carver went on to become a chemist. What is the suffix in the sentence