vvvvvvvvv80 vvvvvvvvv80

21-06-2022
Health

contestada

Question 4 of 5
What can an individual do to further public health?
A. Take vitamins
B. Take health education courses
C. Go to the doctor regularly
D. Eat nutritious food

Respuesta :

Candace061504 Candace061504

22-06-2022

Answer:

B. Take health education courses

Explanation:

i hope this helps

Answer Link

Otras preguntas

How is the effectiveness of the Treaty on Plant Genetic Resources limited? A. It ignores threats to genetic diversity. B. It ignores the loss of biodiversity. C

What are the pros and cons of having a national healthcare system where all members of society are covered by insurance, regardless of their social class rankin

Can someone help me with this

volume of cone lesson 13-1, PLEASE help i cannot do it.

4. Translate the following RNA sequence into a protein chain. AUGGUUACCAGUCGCUUAUAA Please

The circumference of a circle can be found using the formula C = 2rer. Which is an equivalent equation solved for r = CT Or= C(20) O ra 2T 2m re 쯘

PLEASE HELP ME!! Read this passage from Part 1 of “The Purloined Letter.” “And what, after all, is the matter on hand?” I asked. “Why, I will tell you,” replied

Completeaza frazele cu verbele la prezent: attendre,connaître,dire,faire,savoir,vouloir. 1.Je.....le nom du champion. 2.Je....voyager au Canada vacances. 3.Je..

Given that the commuter used public transportation, find the probability that the commuter had a commute of 60 or more minutes.

Rewrite the equation 4x + 2y = 8 in slope-intercept form.