ayri3515 ayri3515

26-04-2024
English

contestada

The word preemption was borrowed directly into English. No verb was borrowed along with it. What modern verb have we formed by backformation?
a. Preempt
b. Empty
c. Contempt
d. Attempt

Respuesta :

Otras preguntas

Xebec Chemicals produces specialty chemical products. The company received an order that will require them to produce 270 units a day. They have decided that th

What belief is implied but not explicitly stated in this excerpt? And if such men can boast of greater degrees of knowledge than any African is entitled to, I s

What household chores do you prefer to do? Which ones do you hate? Explain in seven sentences how your family organizes the household chores. If there is no spe

Read the passage. One way for students to earn money is by babysitting. This work is usually done in the evenings and on weekends, so it is easy to fit into a s

Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provid

Two importance of these trees to the surrounding communities?

How do taxpayer-funded programs or agencies directly affect you and your family? Do you agree with how much taxpayer money is currently allocated to specific pr

Elena has 32 hair ties. Melanie has 8 hair ties. What is the ratio of Elena’s hair ties to Melanie’s hair ties?

A glass is 1 3 full. Then 75cm3 of orange juice is poured in. The glass is now 3 4 full. What is the total volume of the glass?

Write a C program that uses a while statement to determine and print the largest of 10 numbers input by the user. Your program should use three variables, as