petermaya05 petermaya05

23-01-2018
English

contestada

Should colleges accept students with high test scores or students with strong extracurricular backgrounds. How can this excerpt statement be improved

Respuesta :

backwoodsbarbie12 backwoodsbarbie12

23-01-2018

Both, colleges should be considerate that some kids strive to reach their goal but don't always achieve.

Answer Link

Otras preguntas

How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT

LaMont works for a company in downtown Chicago. The company encourages employees to use public transportation (to save the environment) by providing them with t

Which expression is equivalent to the given expression? Assume the denominator does not equal zero. [tex]\frac{14x^{4}y^{6} }{7x^{8}y^{2} }[/tex] A. [tex]\frac{

help me Find the solution pls....

Would paul McLean be likely to think of actors as artists

Which is not an important element of culture? religion literature education language

Answer 1-10 in Spanish.

A. Christianity becomes Axum's state religion. B. Salt becomes a less valuable resource. C. The religion of Islam spreads in Africa. D. African kingdoms lose c

This graph shows a linear relationship between the water level in a tank and time elapsed. Enter the initial water level, in feet, of the water tank.

Someone please help me with this question I’m stuck on it