kandice17rodger kandice17rodger

22-03-2018
History

contestada

How did the Lend-Lease Act help the United States when it entered World War II?

Respuesta :

22-03-2018

The lend lease act provided aid to any country who needed it, thus when WWII began they were trusted and were ailed forces together(also Roosevelt lended Britain arms)

Answer Link

clair1980 clair1980

09-04-2020

Answer:

A.

The United States was able to use military bases in Allied territory.

Explanation:

Answer Link

Otras preguntas

FILL IN THE BLANK. sleep spindles and k-complexes are most often associated with ________ sleep.

Biryani is a rice dish from South Asia. Three students made Alisha's biryani recipe using different-size scoops. If Alisha’s biryani recipe uses 4 cups of rice,

consider the following reaction. at high ph, which species will be present at the greatest concentrations

If art is subjective how can anyone really critique it? what elements could a person discuss to show appreciation for an art piece, even if they do not particul

During a mathematics test, 18 students answered question 1 correctly, 23 students answered question 2 correctly, 8 students got them both correct and 11 student

What do large differences of the means of each group indicate? select the correct answer.

a company that makes products that give high immediate satisfaction but may hurt consumers in the long run makes products. group of answer choices threatening d

The _____ budget is used for the cost of fixed assets like plants and equipment. Multiple Choice master capital production cash cost

in a kickback scheme, the funds come directly from: a. a non-accomplice vendor b. the victim company c. an accomplice vendor d. employees with purchasing author

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul