wahidahadi wahidahadi

25-03-2021
Chemistry

contestada

An ionic bond is a bond between a _ and a . *

A. metal and nonmetal
B. metal and metal
C. nonmetal and nonmetal
D. metalloid and nonmetal

Respuesta :

taylorshamiraca04 taylorshamiraca04

25-03-2021

Answer:

A. Metal and Nonmetal

Explanation:

hope this helps :)

Answer Link

Otras preguntas

Which ocean floor feature is created at a divergent plate boundry?

6. Giselle pays $210 in advance on her account at the athletic club. Each time she uses the club, $15 is deducted from the account. Model the situation with a l

2. You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’. template DNA 3’ CCTACGGTTCGTACCCCGTA

the measures of the angles of a triangle are shown below. solve for x

Swifty Corporation had a 1/1/20 balance in the Allowance for Doubtful Accounts of $35500. During 2020, it wrote off $23000 of accounts and collected $8000 on ac

6sin^2theta = 7- 5costhetaplease include all steps thank you ~ will give branliest !!

What was to be the task of the Supreme Allied Commander?

Select the correct answer. Rachael is making a small budget film. She and her team are working on a limited budget and cannot afford to have a separate photo sh

Please help me fast!!

What is the answer ??????